Review




Structured Review

PerSeptive Biosystems Inc automated nucleic acid synthesizer expedite 8909
Automated Nucleic Acid Synthesizer Expedite 8909, supplied by PerSeptive Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/expedite+8909+automated+dna+synthesizer/pmc10591465__ja3c06500_si_002-37-12-16
Average 90 stars, based on 1 article reviews
automated nucleic acid synthesizer expedite 8909 - by Bioz Stars, 2026-10
90/100 stars

Images

Related Articles

Synthesized:

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides tagged with 2,4-disubstituted 5-aminopyrimidines as recognition elements.
Article Snippet: The canonical purine bases of the natural nucleic acids occupy a central position in the chemist s reasoning of the problem of life s origin.. Their formation from aqueous ammonium cyanide under a variety of potentially prebiotic conditions and the fundamental function these bases fulfill as recognition elements in contemporary life s genetic system constitute facts deemed to be intimately related to each other.. The generational relationship the other type of canonical nucleobases, the pyrimidines, have to HCN, is more complex.

Article Title: Mapping the Landscape of Potentially Primordial Informational Oligomers: Oligodipeptides and Oligodipeptoids Tagged with Triazines as Recognition Elements
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Article Title: Crystal Structure of a Tetrameric DNA Fold-Back Quadruplex.
Article Snippet: DNA can adopt many structures beyond the Watson-Crick duplex.. However, the bounds of DNA structural diversity and how these structures might regulate biological processes is only beginning to be understood.. Here, we describe the 1.05 Å resolution crystal structure of a DNA oligonucleotide that self-associates to form a non-G-quadruplex fold-back structure.

Article Title: Stability of the pH-Dependent Parallel-Stranded d(CGA) Motif
Article Snippet: .. DNA oligonucleotides (Table S1) were synthesized on a 1 μmol scale using standard phosphoramidite chemistry on an Expedite 8909 Nucleic Acid Synthesizer (PerSeptive Biosystems, Framingham, MA) with reagents from Glen Research (Sterling, VA). ..

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides and oligodipeptoids tagged with triazines as recognition elements.
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Article Title: Ten Estrogen-Related Polymorphisms and Endometriosis
Article Snippet: METHODS: In a case–control study, we investigated the genotype frequencies of 10 estrogen metabolizing SNPs in 32 patients with endometriosis and 790 healthy controls using sequencing-on-chip-technology with solidphase polymerase chain reaction on oligonucleotide microarrays: catechol-O-methyltransferase, Val158Met G->A, 17-hydroxysteroid dehydrogenase type 1 (HSD17), vlV A->C, cytochrome P450 (CYP), 17 A2 allele T->C, CYP1A1 MspI RFLP T->C, CYP1A1 Ile462Val A->G, CYP19 Arg264Cys C->T, CYP19 C1558T C->T, CYP 1B1 Leu432Val, CYP1B1 Asn453Ser, and estrogen receptor alpha IVS1 –401>C.. Associations and 2-way interaction models between SNPs were calculated by stepwise logistic regression models.

Article Title: A DNA G-quadruplex/i-motif hybrid
Article Snippet: .. The 11-mer, d(CCAGGCTGCAA), the derivative, d(CCAGGCU Br GCAA) and d(CCAGGCTGC Br AA), and the 22-mer, d(CCAGGCTGCAACCAGGCTGCAA), oligonucleotides were synthesized using standard phosphoramidite chemistry on an Expedite 8909 Nucleic Acid Synthesizer (PerSeptive Biosystems, Inc.), with reagents from Glen Research (Sterling, VA). ..

Modification:

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides tagged with 2,4-disubstituted 5-aminopyrimidines as recognition elements.
Article Snippet: The canonical purine bases of the natural nucleic acids occupy a central position in the chemist s reasoning of the problem of life s origin.. Their formation from aqueous ammonium cyanide under a variety of potentially prebiotic conditions and the fundamental function these bases fulfill as recognition elements in contemporary life s genetic system constitute facts deemed to be intimately related to each other.. The generational relationship the other type of canonical nucleobases, the pyrimidines, have to HCN, is more complex.

Article Title: Mapping the Landscape of Potentially Primordial Informational Oligomers: Oligodipeptides and Oligodipeptoids Tagged with Triazines as Recognition Elements
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides and oligodipeptoids tagged with triazines as recognition elements.
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Purification:

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides tagged with 2,4-disubstituted 5-aminopyrimidines as recognition elements.
Article Snippet: The canonical purine bases of the natural nucleic acids occupy a central position in the chemist s reasoning of the problem of life s origin.. Their formation from aqueous ammonium cyanide under a variety of potentially prebiotic conditions and the fundamental function these bases fulfill as recognition elements in contemporary life s genetic system constitute facts deemed to be intimately related to each other.. The generational relationship the other type of canonical nucleobases, the pyrimidines, have to HCN, is more complex.

Article Title: Mapping the Landscape of Potentially Primordial Informational Oligomers: Oligodipeptides and Oligodipeptoids Tagged with Triazines as Recognition Elements
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Article Title: Crystal Structure of a Tetrameric DNA Fold-Back Quadruplex.
Article Snippet: DNA can adopt many structures beyond the Watson-Crick duplex.. However, the bounds of DNA structural diversity and how these structures might regulate biological processes is only beginning to be understood.. Here, we describe the 1.05 Å resolution crystal structure of a DNA oligonucleotide that self-associates to form a non-G-quadruplex fold-back structure.

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides and oligodipeptoids tagged with triazines as recognition elements.
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

High Performance Liquid Chromatography:

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides tagged with 2,4-disubstituted 5-aminopyrimidines as recognition elements.
Article Snippet: The canonical purine bases of the natural nucleic acids occupy a central position in the chemist s reasoning of the problem of life s origin.. Their formation from aqueous ammonium cyanide under a variety of potentially prebiotic conditions and the fundamental function these bases fulfill as recognition elements in contemporary life s genetic system constitute facts deemed to be intimately related to each other.. The generational relationship the other type of canonical nucleobases, the pyrimidines, have to HCN, is more complex.

Article Title: Mapping the Landscape of Potentially Primordial Informational Oligomers: Oligodipeptides and Oligodipeptoids Tagged with Triazines as Recognition Elements
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Article Title: Mapping the landscape of potentially primordial informational oligomers: oligodipeptides and oligodipeptoids tagged with triazines as recognition elements.
Article Snippet: .. Oligodipeptides and oligodipeptoids were synthesized on an Expedite 8909 Nucleic Acid Synthesizer (Perseptive Biosystems) using a modified PNAprotocol, purified by HPLC (ion exchange) to a minimal purity of 95%% and checked by MALDI-TOF-MS (see Supporting Information). ..

Oligonucleotide Synthesis:

Article Title: Crystal Structure of a Tetrameric DNA Fold-Back Quadruplex.
Article Snippet: DNA can adopt many structures beyond the Watson-Crick duplex.. However, the bounds of DNA structural diversity and how these structures might regulate biological processes is only beginning to be understood.. Here, we describe the 1.05 Å resolution crystal structure of a DNA oligonucleotide that self-associates to form a non-G-quadruplex fold-back structure.

other:

Article Title: Specificity and Efficiency of the Uracil DNA Glycosylase-Mediated Strand Cleavage Surveyed on Large Sequence Libraries
Article Snippet: While the chemical fluidics system (Expedite 8909 nucleic acid synthesizer, PerSeptive Biosystems) provides reagents and solvents, the synchronized computer-controlled optical system serves to pattern UV light via a digital micromirror device (Texas Instruments 0.7 XGA DMD) with 1024 × 768 individually addressable mirrors onto the synthesis area.



Similar Products

90
PerSeptive Biosystems Inc automated nucleic acid synthesizer expedite 8909
Automated Nucleic Acid Synthesizer Expedite 8909, supplied by PerSeptive Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/expedite+8909+automated+dna+synthesizer/pmc10591465__ja3c06500_si_002-37-12-16
Average 90 stars, based on 1 article reviews
automated nucleic acid synthesizer expedite 8909 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Glen Research expedite 8909 nucleic acid synthesizer
Expedite 8909 Nucleic Acid Synthesizer, supplied by Glen Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/expedite+8909+dna+rna+synthesizer/pm38336903-234-14-23
Average 90 stars, based on 1 article reviews
expedite 8909 nucleic acid synthesizer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Thermo Fisher expedite®8909 nucleic acid synthesizer
Expedite®8909 Nucleic Acid Synthesizer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/us11708607-128-19-29
Average 90 stars, based on 1 article reviews
expedite®8909 nucleic acid synthesizer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Thermo Fisher expedite 8909 nucleic acid synthesizer
Expedite 8909 Nucleic Acid Synthesizer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/pmc08302632-233-29-34
Average 90 stars, based on 1 article reviews
expedite 8909 nucleic acid synthesizer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
PerSeptive Biosystems Inc automated nucleic acid synthesizer perseptive biosystems expedite 8909
Automated Nucleic Acid Synthesizer Perseptive Biosystems Expedite 8909, supplied by PerSeptive Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/expedite+8909+automated+dna+synthesizer/pm32896817-79-12-15
Average 90 stars, based on 1 article reviews
automated nucleic acid synthesizer perseptive biosystems expedite 8909 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
PerSeptive Biosystems Inc expedite 8909 nucleic acid synthesizer
Expedite 8909 Nucleic Acid Synthesizer, supplied by PerSeptive Biosystems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/expedite+8909+nucleic+acid+synthesizer/expedite+8909+automated+dna+synthesizer/bio_rxiv__2020__07__02__184911-33-17-22
Average 90 stars, based on 1 article reviews
expedite 8909 nucleic acid synthesizer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results